Transitions and Transversions

Author: L. Grondin

http://rosalind.info/problems/tran/

Sample input

>Rosalind_0209
GCAACGCACAACGAAAACCCTTAGGGACTGGATTATTTCGTGATCGTTGTAGTTATTGGA
AGTACGGGCATCAACCCAGTT
>Rosalind_2200
TTATCTGACAAAGAAAGCCGTCAACGGCTGGATAATTTCGCGATCGTGCTGGTTACTGGC
GGTACGAGTGTTCCTTTGGGT

Sample output

1.21428571429

Source code: tran-grondilu.pl

use v6;

my $default-input = q:to/END/;
    >Rosalind_0209
    GCAACGCACAACGAAAACCCTTAGGGACTGGATTATTTCGTGATCGTTGTAGTTATTGGA
    AGTACGGGCATCAACCCAGTT
    >Rosalind_2200
    TTATCTGACAAAGAAAGCCGTCAACGGCTGGATAATTTCGCGATCGTGCTGGTTACTGGC
    GGTACGAGTGTTCCTTTGGGT
    END

sub MAIN($input-file = Nil) {
    my $input = $input-file ?? $input-file.IO.slurp !! $default-input;
    given $input {
        my @dna;
        for m:g/ '>Rosalind_' <.digit>**4 \n ( <[ACGT\n]>+ ) / {
            push @dna, $_[0].subst: "\n", '', :g;
        }
        my ($transitions, $transversions);
        for (@dna[0].comb Z @dna[1].comb).flat -> $a, $b {
            next unless $a ne $b;
            if "$a$b" eq any  { $transitions++ }
            else { $transversions++ }
        }
        say ($transitions/$transversions).fmt("%0.11f");
    }
}