Counting DNA Nucleotides

Author: L. Grondin

http://rosalind.info/problems/dna/

Sample input

AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC

Sample output

20 12 17 21

Source code: dna-grondilu.pl

use v6;

my $default-input = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC";

sub MAIN(Str $input = $default-input) {
    say "{bag($input.comb)}";
}